View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10222_low_16 (Length: 253)
Name: NF10222_low_16
Description: NF10222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10222_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 41171051 - 41170816
Alignment:
| Q |
1 |
caccttctaccattagtcaccaccaacatctgcattttaactttccattgaccagttgtttgtatttccatgaccgtgagaaacaagtcacacctgtctc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41171051 |
cacctactaccattagtcaccaccaacatctgcattttaactttccattgaccagttgtttgtatttccatgaccgtgagaaacaagtcacaactgtctc |
41170952 |
T |
 |
| Q |
101 |
ataaaaggaaaattgtgaatatacctaataaagcaaccaggaagggtaa-aaaagcttagtttgtcccttatatggcatgtaattctattggtagcggat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41170951 |
ataaaaggaaaattgtgaatatacctaataaagcaaccaggaagggtaaaaaaagcttagtttgtcccttatatggcatgtaattctattggtagcggat |
41170852 |
T |
 |
| Q |
200 |
gtggtagagaacattaaggtgttgtcgtggcattga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41170851 |
gtggtagagaacattaaggtgttgtcgtggcattga |
41170816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University