View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10222_low_19 (Length: 239)
Name: NF10222_low_19
Description: NF10222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10222_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 114 - 224
Target Start/End: Complemental strand, 43407242 - 43407132
Alignment:
| Q |
114 |
ctcgtgctgagagcaacacatgcatagaaacatatatactatcaacatgtactagtactatatgaactcaatcaatgagagacagaaagagacaaggata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407242 |
ctcgtgctgagagcaacacatgcatagaaacatatatactatcaacatgtactagtactatatgaactcaatcaatgagagacagaaagagacaaggata |
43407143 |
T |
 |
| Q |
214 |
ggtatattatt |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
43407142 |
ggtatattatt |
43407132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 81
Target Start/End: Complemental strand, 43407304 - 43407268
Alignment:
| Q |
45 |
actcccttcttctgtatgtgcttttgctgcttcttgt |
81 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
43407304 |
actcccttcttctatatgtgtttttgctgcttcttgt |
43407268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University