View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10224_low_3 (Length: 227)
Name: NF10224_low_3
Description: NF10224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10224_low_3 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 7292987 - 7293213
Alignment:
| Q |
1 |
agggcatctgatgagttaatttttgtgagccaaatttttaaccagatgcattgatttttcaaccaccgctttaatttgtttatattttatttcggaagaa |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7292987 |
agggcacctgatgagttaatttttgtgagccaaatttttaaccagatgcattgatttttcaaccaccgctttaatttgtttatattttatttcagaagaa |
7293086 |
T |
|
| Q |
101 |
gtattttataagattctacgtatatttgtgtgtacaatcaaatggaaaatgacaatatgaaaattatgcataagccaaaaacaacttaggacaataattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7293087 |
gtattttataagattctacgtatatttgtgtgtacaatcaaatggaaaatgacaatatgaaaattatgcataagcgaaaaacaacttaggacaataattt |
7293186 |
T |
|
| Q |
201 |
atatctagaagtgttgataaaaaacga |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7293187 |
atatctagaagtgttgataaaaaacga |
7293213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University