View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10225_high_32 (Length: 233)
Name: NF10225_high_32
Description: NF10225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10225_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 14 - 219
Target Start/End: Complemental strand, 12795270 - 12795064
Alignment:
| Q |
14 |
cagagactgaataa-cccaccagtgaatcctccaaactgaacagaccgccaactgaccaatcaaatgtcaaaaacgaccagaaatggctgagttatacac |
112 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
12795270 |
cagaaactgaataaacccattagtgaatcctccaaactgaacagaccgccaactgaccaatcaaacgtcaaaaatgaccagaaatggctgagttatacac |
12795171 |
T |
 |
| Q |
113 |
atattttgttcaactctagtttgaggtttgtggcccgaaattgatcgaactcatttgatgcacaactatagcacgttcactgttgtgaattctacctatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
12795170 |
atattttgttcaactctagtttgaggtttgtggcccgaaattgaccgaactcgtttgatgcacaaccatagtacgttcactgttgtgaattctacctatc |
12795071 |
T |
 |
| Q |
213 |
tatattt |
219 |
Q |
| |
|
||||||| |
|
|
| T |
12795070 |
tatattt |
12795064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University