View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10225_high_33 (Length: 225)
Name: NF10225_high_33
Description: NF10225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10225_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 6 - 207
Target Start/End: Original strand, 11401385 - 11401586
Alignment:
| Q |
6 |
tgatggaattttatgaaatacacaattagtcaacaccaacgtgtgcaaaagaaatttcagttaattgcaaaatattatgtcaagacaggtcacacaaaca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11401385 |
tgatggaattttatgaaatacacaattagtcaacaccaacgtgtgcaaaagaaatttcagttaattttaaaatattatgtcaagacaggtcacacaaaca |
11401484 |
T |
 |
| Q |
106 |
atatcaacaatgacaaatgacaactgtaagaaaattaaatcaagcataaactagaagattttagaagcattctagaagacaagtcttcaccattaagaaa |
205 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11401485 |
atataaacaatgacaaatgacaaccgtaagaaaattaaatcaagcataaactagaagattttagaagcattccagaagacaagtcttcaccattaagaaa |
11401584 |
T |
 |
| Q |
206 |
tg |
207 |
Q |
| |
|
|| |
|
|
| T |
11401585 |
tg |
11401586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University