View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10225_low_14 (Length: 381)
Name: NF10225_low_14
Description: NF10225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10225_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 9e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 16 - 212
Target Start/End: Original strand, 16822791 - 16822987
Alignment:
| Q |
16 |
atgaagacgatgataaaatagagaatattatatatcatgctttgaacacaatgaata--tatctatccaaaatgaaatcactaatcaaaatcttactaat |
113 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16822791 |
atgaagacgaagataaaatagagaatattatat--catgctttgttaacaatgaatagatatctatccaaaatgaaatcactaatcaaaatcttactaat |
16822888 |
T |
|
| Q |
114 |
ttaacagaaaatctatcaaatcacatgcgcaaaatcaagaaggaattgaatttggtagccgtcattggttgcacaaaatcaccggcaaataattctttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16822889 |
ttaacagaaaatctatcaaatcacatgcgcaaaatcaagaaggaattgaatttggtagccgtcattggttgcacaaaatcaccggcaaataattctttg |
16822987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 245 - 362
Target Start/End: Original strand, 16823019 - 16823136
Alignment:
| Q |
245 |
ggcgcgtctctttctctctcccctgagtagcaagcaatgcaattaaaccaccatttaatgcaattgcaccctctcaatacgctcttcaattactcctctt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16823019 |
ggcgcgtctctttctctctcccctgagtagcaagcaatgcaattaaaccaccatttaatgcaattgcaccctctcaatacgctcttcaattactcctctt |
16823118 |
T |
|
| Q |
345 |
ccatttcttcctctatct |
362 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
16823119 |
ccatttcttcctctatct |
16823136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University