View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10225_low_18 (Length: 321)
Name: NF10225_low_18
Description: NF10225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10225_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 17 - 307
Target Start/End: Original strand, 25869248 - 25869543
Alignment:
| Q |
17 |
agatttagcagcttctacaatctcatttt-ttatcttcatccccaatcatgaagataatatgttagttaagcatttgatcttgactttggacgacaactg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
25869248 |
agatttagcagcttctacaatctcatttttttatcttcatctccaatcatgaagttaatatgttatttaagcatttgatcttgactttggacaacaactg |
25869347 |
T |
|
| Q |
116 |
cgatgagttattatcctcaataaagttagcaacttcgcaaaacaaaaaattatcatactttacaatcttctttagttcaggaaaatgccatgaataccat |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25869348 |
cgatgagttattatcttcaataaagttagcaacttcgcaaaacaaataattatcatactttacaatcttctttagttcaggaaaatgccatgaataccat |
25869447 |
T |
|
| Q |
216 |
tctctgactcatggagaatgaatcatggtatccttatcaagcttatcaatatgga----tgcttgaatgaccatattgtcgacgctattaacattt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25869448 |
tctctgactcatggagaatgaatcatggtatccttatcaagattatcaatatggagaattgcttgaatgaccatattgtcgacgctattaacattt |
25869543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 126 - 221
Target Start/End: Complemental strand, 42933527 - 42933435
Alignment:
| Q |
126 |
ttatcctcaataaagttagcaacttcgcaaaacaaaaaattatcatactttacaatcttctttagttcaggaaaatgccatgaataccattctctg |
221 |
Q |
| |
|
|||||||||||||| || ||||||| ||| ||||| ||||||||| ||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
42933527 |
ttatcctcaataaattttgcaactttgcagtacaaataattatcat---ttacaatcttcacaagttcaggaaaatgccatgaataccactctctg |
42933435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University