View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10225_low_20 (Length: 317)
Name: NF10225_low_20
Description: NF10225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10225_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 303
Target Start/End: Complemental strand, 41133248 - 41132961
Alignment:
| Q |
17 |
catctttaatgatgaagctaaaggcattcatagatatgtacagtgaagatgagattagggggatcttgaatgaatcaggcaatgattttccaactgatgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41133248 |
catctttaatgatgaagctaaaggcattcgtagatatgtacagtgaagatgagattagggggatcttgaatgaatcaggcaatgattttacaactgatgt |
41133149 |
T |
 |
| Q |
117 |
tgattttgaagccttcttaatggtaagtaaattttatggttttcacatttatttttcaatattattaatagaaacgtgttttgttactag-nnnnnnnnn |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41133148 |
tgattttgaagccttcttaacggtaagtaaattttatggttttcacatttatttttcaatattattaatagaaacgtgttttgttactagaaaaaaaaaa |
41133049 |
T |
 |
| Q |
216 |
nnnccgcctctaacttaaacagatatgtaagcgtacacaagaacacaaacaattgatcatagttcggctaattgtgtctatgtctctg |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41133048 |
ataccgcctctaacttaaacagatatgtaagcgtacacaaaaacacaaacaattgatcatagttcggttaattgtgtctatgtctctg |
41132961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University