View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10225_low_24 (Length: 279)
Name: NF10225_low_24
Description: NF10225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10225_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 268
Target Start/End: Complemental strand, 39063180 - 39062929
Alignment:
| Q |
20 |
cctagtgcatgccgcaaatatatcaaatgaaagaaaatcctctaatgatgtaggcatatcattggattagatgtctgctttaagaaaagggggattttca |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39063180 |
cctagtgcatgccgcaaatatatcaaaggaaagaaaatcctctagtgatgtaggcatatcattggattagatgtctgctttaagaaaagggggattttca |
39063081 |
T |
 |
| Q |
120 |
aagttagtagtttataaggatggtaacaataagatgattacaatagcatattgagttgat---gaggcaaacacaatgaactcgtggtagtggattctga |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39063080 |
aagttagtagtttacaaggatggtaacaataagatgattacaatagcatattgagttgatgacgaggcaaacacaatgaactcgtggtagtggattctga |
39062981 |
T |
 |
| Q |
217 |
atttatcgcttaatgaacttcaaaatatttaaccaaaagtgtatggtttcat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39062980 |
atttatcgcttaatgaacttcaaaatatttaaccaaaagtgtatggtttcat |
39062929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University