View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10225_low_27 (Length: 264)
Name: NF10225_low_27
Description: NF10225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10225_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 47234639 - 47234886
Alignment:
| Q |
1 |
ctttatatgcaaaacattttcagtatggtttggtttggtgggttaggacaacttctgacgagtctatgaaaaaggaaaataggtttgtgtttttatggcg |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47234639 |
ctttataagcaaaacattttcagtatggtttggcttggtgggttaggacagtttctgacgagtctatgaaaaaggaaaataggtttgtgtttttatggcg |
47234738 |
T |
|
| Q |
101 |
gcttacttacaggtggtgtatgcagctactgcctaactagctagggctagctcatcaggtagaaatgaaatgacagacaaaaatgctttgaagttcaaaa |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47234739 |
gcttacttacaggcggtgtatgcagctactgcctaactagctagggctagctcatcaggtagaaatgaaatgacagacaaaaatgctttgaagttcaaaa |
47234838 |
T |
|
| Q |
201 |
tcctaactaactagcttgtgtagctccccaaagccaaaccaagatact |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47234839 |
tcctaactaactagcttgtgtagctccccaaagccaaaccaagatact |
47234886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University