View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10225_low_35 (Length: 240)
Name: NF10225_low_35
Description: NF10225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10225_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 2646889 - 2646666
Alignment:
| Q |
1 |
ttcccatagaccaaattaattagttaaaaagaatactttgaattttaattcgtgtgcttgaacaatataaatcctaaggtagagnnnnnnnn-tgaaaga |
99 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2646889 |
ttcccatggaccaaattaattagttaaaaagaatactttgaattttaattcgtgtgcttgaacaatataaatcctaaggtagagaaaaaaatatgaaaga |
2646790 |
T |
|
| Q |
100 |
gtataagtactcacatcaaaatcaaactagccctaccacttcccactcccttcccatgcttctaaccaattttaaagttttgaagaaagaataatgatcc |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2646789 |
gtataaatactcacatcaaaatcaaactagccctaccacttcccactcccttcccatgcttctaaccaattttaaagttttgaagaaagaataatgatcc |
2646690 |
T |
|
| Q |
200 |
tatatgcactttgcatccattatc |
223 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
2646689 |
tatatgcactttgcgtccattatc |
2646666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University