View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10226_high_26 (Length: 208)

Name: NF10226_high_26
Description: NF10226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10226_high_26
NF10226_high_26
[»] chr5 (1 HSPs)
chr5 (18-192)||(17429049-17429223)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 17429223 - 17429049
Alignment:
18 gagacgattgagtggctgcttcaacaggcagagccagccgtcatcgccgccaccggaacaggaacaattccggccaactttacttcacttaatatttctc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
17429223 gagacgattgagtggctgcttcaacaggcagagccagccgtcatcgccgccaccggaacaggaacaattccggccaactttacttcacttaatatatctc 17429124  T
118 ttagaagctcaggctcaaccatgtctgcaccgtctcactattttcgaggtaactactttaaccctagctcgttct 192  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
17429123 ttagaagctcaggctcaaccatgtctgcgccgtctcactattttcgaggtaactactttaaccctagctcgttct 17429049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University