View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10226_high_7 (Length: 371)
Name: NF10226_high_7
Description: NF10226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10226_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 19 - 325
Target Start/End: Complemental strand, 41290067 - 41289761
Alignment:
| Q |
19 |
ggagaaaccatcgtttgcgtagtgaagagaaccggatatgtgaccatcataactcctctcatcgtctctcacatcaacgatggcgatggttggttggcgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41290067 |
ggagaaaccatcgtttgcgtagtgaagagaaccggatatgtgaccatcataactcctctcatcgtctctcacatcaacgatggcgatggttggttggcgt |
41289968 |
T |
|
| Q |
119 |
ttgagagagagaagctcggagcctgtgacgtatgagatactgtgagccatcttctctactggtaattcactatttctacgctgactactctttccgactc |
218 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41289967 |
ttgagagagagaagctcggagcctgttacgtatgagatactgtgagccatcttctctgctggtaattcactatttctacgctgactactctttccgactc |
41289868 |
T |
|
| Q |
219 |
ccatgcctctcagattgacttttatttggggaaacagaggctggccccgaatccaactcattttgcaacccaaccggatgcatgcacacggtgcactttt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41289867 |
ccatgcctctcagattgacttttatttggggaaacagacgctggccccgaatccaactcattttgcaacccaaccggatgcatgcacacggtgcactttt |
41289768 |
T |
|
| Q |
319 |
cattaac |
325 |
Q |
| |
|
||||||| |
|
|
| T |
41289767 |
cattaac |
41289761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University