View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10226_low_12 (Length: 355)
Name: NF10226_low_12
Description: NF10226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10226_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 10210106 - 10210039
Alignment:
| Q |
1 |
catataaagatataacaataccattttatttctctgtaatcgagcagcacgtgctcctttaccaacat |
68 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10210106 |
catataaagatataacagtaccattttatttctctgtaatcgagcagcacgtgcacctttaccaacat |
10210039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University