View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10226_low_23 (Length: 246)
Name: NF10226_low_23
Description: NF10226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10226_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 12018821 - 12019022
Alignment:
| Q |
18 |
aacataagataacaatacttatgaatacagtttatagcttatnnnnnnntaatttgactttattttttctcttactataaaaacatcgtatatatatgtt |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
12018821 |
aacataagataacaatacttatgaaaacagtttatagcttataaaaaaacaatttgactttattttttctcttactataaaaatatcgtaaatatatgtt |
12018920 |
T |
|
| Q |
118 |
tttatcatgataagaaattgtgagataagctatttatcaaaataaagcctaaacaccttcaa-ttttctgtaaacaaccgaacatatcctaaaactattt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12018921 |
tttatcatgataagaaattgtgagataagctatttatcaaaataaagcctaaacaccttcaatttttttgtaaacaaccgaacatatcctaaaactattt |
12019020 |
T |
|
| Q |
217 |
ga |
218 |
Q |
| |
|
|| |
|
|
| T |
12019021 |
ga |
12019022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University