View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10226_low_28 (Length: 240)
Name: NF10226_low_28
Description: NF10226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10226_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 3828420 - 3828643
Alignment:
| Q |
1 |
aaacgatcatgcaggtttatatcactcttaaaaatatcaattacgt-agttgctttagagaaacaatcgacctttcctataaccaaactccagcgtagtt |
99 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3828420 |
aaacgatcatgcacgtttatatcactcttaaaaatgtcaattacatcagttgctttagagaaacaatcgacctt-cctataaccaaactccagcgtagtt |
3828518 |
T |
 |
| Q |
100 |
ggaacctacgnnnnnnngccaaaatcttcatgtgattaatacacgagctaggtaccattactgccatagtaaccatgtaggtgatccccatgatgtacac |
199 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3828519 |
ggaacctatgaaaaaaggccaaaatcttcatgtgattaatacacgagctaggtaccattactgccatagtaaccatgtaggtgatccccatgatgtacac |
3828618 |
T |
 |
| Q |
200 |
aaatcagacatttaaacccctaaac |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3828619 |
aaatcagacatttaaacccctaaac |
3828643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University