View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10226_low_30 (Length: 227)
Name: NF10226_low_30
Description: NF10226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10226_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 7 - 214
Target Start/End: Complemental strand, 28667639 - 28667432
Alignment:
| Q |
7 |
tgtggtaagtccagaagttgaatccaaacctacgcatgtgtgagacactgaaagtacttgttgaaatccttggctcatctagaaagcctcaacagtccca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
28667639 |
tgtggtaagtccagaagttgaatccaaacctgcgcatgtgtgagacgctgagagtacttgttgaaatccttggcccatctagaaagcctcaacagtctca |
28667540 |
T |
|
| Q |
107 |
acttcaaatttacaatccccatagcaagagatgcacgcacatcttcatctgtggaggaagaaaattcataaaatccacgcccaagagaaatcagtttcca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
28667539 |
acttcaaatttacaatccccatagcaagagatgcacacacatcttcatctgtggaggaagaaaattcataaaatccacacccaagagaaatcagttgcca |
28667440 |
T |
|
| Q |
207 |
tgctccct |
214 |
Q |
| |
|
|| ||||| |
|
|
| T |
28667439 |
tggtccct |
28667432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 116
Target Start/End: Complemental strand, 17111240 - 17111128
Alignment:
| Q |
4 |
tcatgtggtaagtccagaagttgaatccaaacctacgcatgtgtgagacactgaaagtacttgttgaaatccttggctcatctagaaagcctcaacagtc |
103 |
Q |
| |
|
|||||||| ||||||||||| | |||||||||| ||||||||||||| |||| |||| ||||| |||||||||| |||| ||||||| |||||| | |
|
|
| T |
17111240 |
tcatgtggcaagtccagaagccggatccaaacctgtgcatgtgtgagacgctgagagtatttgttaaaatccttggaccatcgggaaagccgcaacaggc |
17111141 |
T |
|
| Q |
104 |
ccaacttcaaatt |
116 |
Q |
| |
|
|| ||| |||||| |
|
|
| T |
17111140 |
ccgactgcaaatt |
17111128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University