View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10226_low_32 (Length: 220)
Name: NF10226_low_32
Description: NF10226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10226_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 64 - 210
Target Start/End: Original strand, 8755663 - 8755810
Alignment:
| Q |
64 |
attttgaaacggagggagtactatttagtcttttcactcgctgatccc-atatgttatgaaaaatttgattggaactcgaaactcaatatttataggatc |
162 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8755663 |
attttaaaacggagggagtactatttagtattttcacttgctcatccatatatgttatgaaaaatttgattggaactcgaaactcaatatttataggata |
8755762 |
T |
|
| Q |
163 |
gatgccaactggattttgggggctgtggaatctattttgcctttgctt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8755763 |
gatgccaactggattttgggggctgtggaatctattttgcctttgctt |
8755810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University