View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10226_low_33 (Length: 218)
Name: NF10226_low_33
Description: NF10226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10226_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 10 - 201
Target Start/End: Original strand, 47941594 - 47941786
Alignment:
| Q |
10 |
aggagcagagatacgatctgaagtataccctgaaagtgaagcatataatctcaatcaatcaatgtaaccnnnnnnn-tgcagcataatagtaagaatgaa |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47941594 |
aggagcaaagatacgatctgaagtataccctgaaagtgaagcatataatctcaatcaatcaatgtaaccataaaaaatgcagcataatagtaagaatgaa |
47941693 |
T |
|
| Q |
109 |
tgaatacctttagcagaatagttgttatttgtggcagtagagaaatccctagcggaaagaacttccaatagatgattcctgtttcatgataat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47941694 |
tgaatacctttagcagaatagttgttatttgtggcagtagagaaatccctagcgtaaagaacttccaatagatgattcctgtttcatgataat |
47941786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University