View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10226_low_8 (Length: 381)
Name: NF10226_low_8
Description: NF10226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10226_low_8 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 1e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 20 - 214
Target Start/End: Complemental strand, 47585926 - 47585735
Alignment:
| Q |
20 |
caaatatgtaaatttcacaaaagcatacaagtctatatacaaaaaattctcacagttcatgcatgtaataagctaacaacacttcatttacaacatctaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47585926 |
caaatatgtaaatttcacaaaagcatacaagtctatatacaaaaaattctcacagttcatgcatgtaataagctaacaacacttcatttacaacatctaa |
47585827 |
T |
|
| Q |
120 |
aatgccgcctcagggaatgttcttaaattattgttccaaagataatatttgaaggatttacatgtaatatactacatacttttgatagaacaaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47585826 |
aatgccgcctcagggaatgttcttaaattattgttccaaagataatatttgaaggatttacatg---tatactacatacttttgatagaacaaaa |
47585735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 212 - 352
Target Start/End: Original strand, 30224071 - 30224212
Alignment:
| Q |
212 |
aaacaggtgctaaagaaactcctaaaattgtatgataaaaactggcaatgtattgggtaagagaacta-agagctttattggatgttatatttgaagaag |
310 |
Q |
| |
|
|||| |||||| |||||||||||||| |||| |||||||||||||||| ||| | | |||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
30224071 |
aaacgggtgcttaagaaactcctaaagttgtttgataaaaactggcaacttatcgaggaagagaactatagagctttattggatgctatatttgaagaag |
30224170 |
T |
|
| Q |
311 |
gcgatggttttgaggtgtttttctcactttatttttacccct |
352 |
Q |
| |
|
|||||| |||||||||| ||||||| |||||||||||||||| |
|
|
| T |
30224171 |
gcgatgattttgaggtggttttctcgctttatttttacccct |
30224212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 264 - 362
Target Start/End: Complemental strand, 82032 - 81933
Alignment:
| Q |
264 |
ttgggtaagagaacta-agagctttattggatgttatatttgaagaaggcgatggttttgaggtgtttttctcactttatttttacccctgccctctccc |
362 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
82032 |
ttggggaagagaactatagagcttcattggatgctatatttgaagaaggcgatggttttgaggtgtttttctcactttatttttacccctgccctctccc |
81933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University