View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10227_high_5 (Length: 343)
Name: NF10227_high_5
Description: NF10227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10227_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 17 - 324
Target Start/End: Complemental strand, 43747220 - 43746913
Alignment:
| Q |
17 |
cacagagtttccttgcagaacacgtttgcaaaagggtggtctactgaatgaagatacatgaacacaaattttttatcttgttctgctaacttcatagctt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43747220 |
cacagagtttccttgcagaacacgtttgcaaaagggtggtctactgaatgaagatacatgaacacaaatttttgatcttgttctgctaacttcatagctt |
43747121 |
T |
|
| Q |
117 |
cattgaaacgacaagcgtaaaagaagggatgtttgttgccatattgttgctcaaaattatcgtgaaaagcccattcttctggagctgctaaggaattttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43747120 |
cattgaaacgacaagcgtaaaagaagggatgtttgttgccatattgttgctcaaaattatcgtgaaaagcccattcttctggagctgctaaggaattttg |
43747021 |
T |
|
| Q |
217 |
tggttgtggagggtctaaaaattgtaatggaaagtttgcattttgatttcttcttcttcttcctattcctacaaagctcattatgctccgaggaaggctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43747020 |
tggttgtggagggtctaaaaattgtaatggaaagtttgcattttgatttcttcttcttcttcctattcctacaaagctcattatgctccgaggaaggctt |
43746921 |
T |
|
| Q |
317 |
gtcattcg |
324 |
Q |
| |
|
|||||||| |
|
|
| T |
43746920 |
gtcattcg |
43746913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University