View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10227_high_9 (Length: 270)
Name: NF10227_high_9
Description: NF10227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10227_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 9231972 - 9231708
Alignment:
| Q |
1 |
catggttggtgattcttagctagacaattttgatggaataggataaaaattgaagcaaatatttttaccaatgtttgtagttgtacaaatgatgaacaag |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9231972 |
catggttggtgatgcttagctagacaattttgatggaataggataaaaattgaagcaaatatttttaccaatgtttgtagttgtacaaatgatgaacaag |
9231873 |
T |
|
| Q |
101 |
aaaatcgagcttgtcttttcatcattcaagtcttcnnnnnnntatgaaattttttaaaacaagccctcatgagaaaatgttgtgattggtttatgttttt |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9231872 |
aaaattgagcttgtcttttcatcattcaagtcttcaaaaaaatatgaaattttttaaaacaagccctcatgagaaaatgttgtgattggtttatgttttt |
9231773 |
T |
|
| Q |
201 |
aaattttataaatgggtcaatcatttatcattaggttgccaccatatctagctgcctttgcttct |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
9231772 |
taattttataaatgggtcaatcatttatcattaggttgccaccatatctagctgtctttgtttct |
9231708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 9386673 - 9386733
Alignment:
| Q |
1 |
catggttggtgattcttagctagacaattttgatggaataggataaaaattgaagcaaata |
61 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| | | || || |||||||||||||| |
|
|
| T |
9386673 |
catggttggtgatgcttagcaagacaattttgatgagaaatgagaagaattgaagcaaata |
9386733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University