View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10227_low_12 (Length: 288)
Name: NF10227_low_12
Description: NF10227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10227_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 70 - 232
Target Start/End: Original strand, 10145902 - 10146064
Alignment:
| Q |
70 |
ttcaagcaaacgctaactatgttggatgcatagataatgctttcttgagtgtgaacaatctaaaattgtaaaataatcattaatattttcaagaaaatag |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10145902 |
ttcaagcaaacgctaactatgttggatgcatagataatgctttcttgagtgtgaacaatctaaaattgtaaaataatcattaatattttcaagaaactag |
10146001 |
T |
 |
| Q |
170 |
aagaaagtggtatctaagttaacgaatgcagactttcatctttccctccatagctctctgctc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10146002 |
aagaaagtggtatctaagttaacgaatgcagactttcatctttccttccatagctctctgctc |
10146064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University