View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10227_low_6 (Length: 353)
Name: NF10227_low_6
Description: NF10227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10227_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 108 - 224
Target Start/End: Original strand, 4559655 - 4559771
Alignment:
| Q |
108 |
ctattgtaaagttgtaagtttctcaacggttagtttacatgacaacaaaaaattgcagtattaataagaatattcatactttgatttgacacatttgtga |
207 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4559655 |
ctatggtaaagttgtaagtttctcaacggttagtttacatgacaacaaaaaattgtagtattaataagaatatttatactttgatttgacacatttgtga |
4559754 |
T |
|
| Q |
208 |
ttttaaaaacatgaatt |
224 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
4559755 |
ttttaaaaacataaatt |
4559771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 14 - 91
Target Start/End: Original strand, 4557140 - 4557217
Alignment:
| Q |
14 |
gtttgaacatttatgatcgtaaatttggtttttgcaatgtgatcaatgcaaaaatgtgggacatgtatatatgtgcac |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4557140 |
gtttgaacatttatgatcgtaaatttggtttttgcaatgtgctcaatgcagaaatgtgggacatgtatatatgtgcac |
4557217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University