View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10228_high_2 (Length: 375)
Name: NF10228_high_2
Description: NF10228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10228_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 56 - 357
Target Start/End: Complemental strand, 48897679 - 48897385
Alignment:
| Q |
56 |
aaattcttgatatagtttgttgttgtatctatcatttcccgacaataaatatgggtatcagagtgaccggtgcgtttcaaaatttaatttaattcatatt |
155 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48897679 |
aaattcttgatatagtttgttgttgtaactatcatttcccgacaataaatatgggtatcagagtgaccggtgcgtttcaaaattttatttaattcatatt |
48897580 |
T |
|
| Q |
156 |
attaacaaaatgcttcagattcacgtgaacttcaccaacaaaatgcataagtaaccataaaagctacttgcgagatggttagttgattcgttcattatgg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48897579 |
attaacaaaatgcttcagattcacgtgaacttcaccaacaaaatgcataagtaaccataaaagctacttgcgagatggttagttgattcgttcattatgg |
48897480 |
T |
|
| Q |
256 |
tgtggggaccacacaatgaagcaaagcaaaactagcttgttctttgccgctgcatgctacggtggtgactggtgacaataaatctcctgcgtgggcacta |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48897479 |
tgtggggaccacacaatgaagcaaagcaaaactagcttgttctttgccgctgcatgctacggtgg-------tgacaataaatctcctgcgtgggcacta |
48897387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 51
Target Start/End: Complemental strand, 48897726 - 48897698
Alignment:
| Q |
23 |
ataatggtgtgtaattaagaaaagatgtt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48897726 |
ataatggtgtgtaattaagaaaagatgtt |
48897698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University