View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10228_low_11 (Length: 240)
Name: NF10228_low_11
Description: NF10228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10228_low_11 |
 | |
|
| [»] scaffold0037 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0037 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 29040 - 29282
Alignment:
| Q |
1 |
ctcaaatattgtttgataactcacagagtatctagcaaaccattacccctataaccataaggttgcgctcaaaaccatcca------------------t |
82 |
Q |
| |
|
|||||||||||| || || ||||||||||| |||||| | ||||||||||||||||||||||||| ||||||||||||| | | |
|
|
| T |
29040 |
ctcaaatattgtatggtagctcacagagtaactagcagaacattacccctataaccataaggttgtgctcaaaaccatctaaaccctgagataaattggt |
29139 |
T |
|
| Q |
83 |
ctaaac-catcaggtgtgaataaaaatctgtaataaccagattgcaaaacatgttcacaaatatgtcaataagagtaaattgatataacagcccataatc |
181 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
29140 |
ctaaaatcatcaggtgtgaataaaaatttgtaataaccagattgcaaaacatgttcacaaatatttcaattagagtaaattgatataacatcccaaaatc |
29239 |
T |
|
| Q |
182 |
caatgtttgtaggaatgtattctccaacatatatgtcagagct |
224 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
29240 |
caatgttagtaggaatgtatcctccaacatatatgtcagagct |
29282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 10425843 - 10425904
Alignment:
| Q |
1 |
ctcaaatattgtttgataactcacagagtatctagcaaaccattacccctataaccataagg |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10425843 |
ctcaaatattgtttgataactcacagagtatctagcaaaccattacccctataaccataagg |
10425904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University