View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10228_low_16 (Length: 223)
Name: NF10228_low_16
Description: NF10228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10228_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 32191330 - 32191278
Alignment:
| Q |
169 |
ctatgaggtacaactaatttgtctggaaattgctcttctccttcttaaaatta |
221 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
32191330 |
ctatgaggcacaactaatttttctggaaattgctcttctccctcttaaaatta |
32191278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 90 - 140
Target Start/End: Complemental strand, 32191373 - 32191323
Alignment:
| Q |
90 |
tgtatattgttaaagaggtgtataagttagtagtggatcataactatgagg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32191373 |
tgtatattgttaaagaggtgtataagttagcgttggatcataactatgagg |
32191323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University