View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10229_high_16 (Length: 235)
Name: NF10229_high_16
Description: NF10229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10229_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 48750987 - 48750782
Alignment:
| Q |
14 |
aagaagaaacagtgtgccatgaccgataatgacttgtgtcatgtttgtaatctgagattatgcttcatgcattcaaagattgtgggagaggtatgcaaaa |
113 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48750987 |
aagaagaaacagtgtaccatgaccgataatgacttgtgttatgtttgtaatatgagattatgcttcatgcattcaaagattgtgggagaggtatgcaaaa |
48750888 |
T |
 |
| Q |
114 |
ttgtggaagaggtgtgcaaatttgaagatttttcaaggtggttgataataatcaaatgttcttacaatccaatttagaagaccggttccgattcaattta |
213 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||| |||| | |
|
|
| T |
48750887 |
ttgtggaagaggtatgcaaatttgaagatttttcaaggtggttgataataatc-aatgttcttacaatccaatttagaagactggttctgattaaattca |
48750789 |
T |
 |
| Q |
214 |
tcttgtg |
220 |
Q |
| |
|
||||||| |
|
|
| T |
48750788 |
tcttgtg |
48750782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University