View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10229_low_13 (Length: 250)
Name: NF10229_low_13
Description: NF10229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10229_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 48750988 - 48751232
Alignment:
| Q |
1 |
atcgtcgttagagttcgccaaatcttccacaacaaaaacttgatctttttgggtcccttccaacgccacgtta-------tagcagtaactgaattattt |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
48750988 |
atcgtcattagagttcgccaaatcttccacaacaaaaacttgatctttttaggtcccttccaacaccacgttaatacatttagcagtaactgaattattt |
48751087 |
T |
 |
| Q |
94 |
atcaaactgctcactcgtaatagagacgcgtaggctagaaattcccataatttttcctttccaggcaattaaatctcgctgatcaattctatgagaggga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48751088 |
atcaaactgctcactcgtaatagagacgcgtaggctagaaattcccataatttttcctttccaggcaattaaatctcgttgatcaattctatgagaggga |
48751187 |
T |
 |
| Q |
194 |
atggcgaggatagcatcaatcacataccaaggcagcttttgtctc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48751188 |
atggcgaggatagcatcaatcacataccaaggcagcttttttctc |
48751232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University