View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10229_low_2 (Length: 443)
Name: NF10229_low_2
Description: NF10229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10229_low_2 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 2e-78; HSPs: 18)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 149 - 322
Target Start/End: Complemental strand, 24552707 - 24552532
Alignment:
| Q |
149 |
gaagataagcagtacttgtagttgcagaaatgg--aatgtagcagggcggcctcttgcaatgggatcaggagatatttgaacttctttaacctcaatatc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24552707 |
gaagataagcagtacttgtagttgcagaaatggtgaatgtagcagggcggcctcttgcaatgggatcaggagatatttgaacttctttaacctcaatatc |
24552608 |
T |
 |
| Q |
247 |
atagctagctttcttatctgtggcaaacatacaagataatcaggtaatatagtttattcaataaaagcaacactaa |
322 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
24552607 |
atagctagctttcttatctgtggcatacatagaagataattaagtaatatagtttattcaataaaagcaacactaa |
24552532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 149 - 268
Target Start/End: Complemental strand, 24562726 - 24562605
Alignment:
| Q |
149 |
gaagataagcagtacttgtagttgcagaaatgg--aatgtagcagggcggcctcttgcaatgggatcaggagatatttgaacttctttaacctcaatatc |
246 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||| |||||||||||| ||| |||||||||||||||||| ||||||| | || ||| |
|
|
| T |
24562726 |
gaagataagcattacttgtatttgcagaaatggtgaatgtagcaggttggcctcttgcaacggggtcaggagatatttgaactcctttaacttgaacatc |
24562627 |
T |
 |
| Q |
247 |
atagctagctttcttatctgtg |
268 |
Q |
| |
|
||||||| |||||||| ||||| |
|
|
| T |
24562626 |
atagctatctttcttacctgtg |
24562605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 361 - 427
Target Start/End: Complemental strand, 47499033 - 47498967
Alignment:
| Q |
361 |
ctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||||||| ||||||||||||||| || ||||| |
|
|
| T |
47499033 |
ctgtttggataaacaacttatttgcagcttatagcacaagtgcttatcatgataagcgcttgtgtat |
47498967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 91 - 140
Target Start/End: Complemental strand, 24552798 - 24552749
Alignment:
| Q |
91 |
ataaagagacaccaaatgcatgaaaatggatataacaatctaaatttaaa |
140 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
24552798 |
ataaagagacaccaaatgcatgagaatagatataacaatctaaatttaaa |
24552749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 361 - 425
Target Start/End: Original strand, 473036 - 473100
Alignment:
| Q |
361 |
ctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgt |
425 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| | |||||||| |||||| |||||| |
|
|
| T |
473036 |
ctgtttggataaacaacttatttgcagcttacaacaaaagcgcttatcatggtaagcgcttatgt |
473100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 359 - 427
Target Start/End: Complemental strand, 5894355 - 5894287
Alignment:
| Q |
359 |
tcctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||||||||||||| ||||| || |||||| | |||||||| ||||||||||||||| |||||||| |
|
|
| T |
5894355 |
tcctgtttggataaacagcttatttgaagcttatagcacaagtgcttatcatgataagcgcttatgtat |
5894287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 363 - 427
Target Start/End: Complemental strand, 33541906 - 33541842
Alignment:
| Q |
363 |
gtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||||||||||||||| ||||| ||| | |||||||| ||||||||||||||| |||||||| |
|
|
| T |
33541906 |
gtttggataaacaacttatttgcagtttatagcacaagtgtttatcatgataagcgcttatgtat |
33541842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 51688576 - 51688637
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttat |
423 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | ||||||| ||||||||||||| |||||| |
|
|
| T |
51688576 |
tgtttggataaacaacttatttgcagcttatagtacaagtgcttatcatgataagtgtttat |
51688637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 82 - 145
Target Start/End: Complemental strand, 24562824 - 24562763
Alignment:
| Q |
82 |
cacacgtggataaagagacaccaaatgcatgaaaatggatataacaatctaaatttaaaaaaca |
145 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
24562824 |
cacatgtgcataaagagacaccaaatgcatgaaaat--atagaacagtctaaatttaaaaaaca |
24562763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 360 - 416
Target Start/End: Complemental strand, 27820531 - 27820475
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | || ||| | ||||||||||||| |
|
|
| T |
27820531 |
cctgtttggataaacaacttatttgcagcttatagcataagcgcttatcatgataag |
27820475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 427
Target Start/End: Original strand, 37473268 - 37473335
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||| ||||||||| |||| |||||||| |
|
|
| T |
37473268 |
cctgtttggataaacaacttatttgcagcttattgcacaagttcttatcatgacaagcacttatgtat |
37473335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 427
Target Start/End: Complemental strand, 41195395 - 41195328
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| | |||||| | ||||| |||||| || |||||||| |
|
|
| T |
41195395 |
cctgtttggataaataacttatttgcagcttatagcacaagcgcttatcctgataatcgcttatgtat |
41195328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 362 - 416
Target Start/End: Original strand, 8081769 - 8081823
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
8081769 |
tgtttggataaacaacttatctgcagcttatagattaagtgattatcatgataag |
8081823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 24552517 - 24552475
Alignment:
| Q |
384 |
gcagcttacaacacaagtgattatcatgataagcgtttatgta |
426 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
24552517 |
gcagcttatagcacaagtgattatcatgataagcgcttatgta |
24552475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 414
Target Start/End: Complemental strand, 33546651 - 33546597
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgata |
414 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| | |||||||| ||||||||||| |
|
|
| T |
33546651 |
cctgtttggataaacagcttattcgcagcttaaagcacaagtgtttatcatgata |
33546597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 362 - 400
Target Start/End: Original strand, 46423151 - 46423189
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaag |
400 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
46423151 |
tgtttggataaacaacttatttgcagcttataacacaag |
46423189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 416
Target Start/End: Original strand, 22343957 - 22344013
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||| |||||| | ||||||||||||| |
|
|
| T |
22343957 |
cctgtttggataatcaacttatttgcaacttaccgcacaagcgcttatcatgataag |
22344013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 363 - 427
Target Start/End: Complemental strand, 27146436 - 27146372
Alignment:
| Q |
363 |
gtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||||||| | ||||| ||||||||| | || |||| ||||||||||||||||||||||| |
|
|
| T |
27146436 |
gtttggataaatagcttatttgcagcttatagcataagtacatatcatgataagcgtttatgtat |
27146372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 2e-16; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 359 - 427
Target Start/End: Complemental strand, 39659710 - 39659642
Alignment:
| Q |
359 |
tcctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| | ||||| || ||||||||||||||| |||||||| |
|
|
| T |
39659710 |
tcctgtttggataaacaacttatttgcagcttagagcacaaatgcttatcatgataagcgcttatgtat |
39659642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 360 - 411
Target Start/End: Original strand, 4606860 - 4606911
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatg |
411 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
4606860 |
cctgtttggataaacaacttattcgcagcttataacacaagtgcttatcatg |
4606911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 360 - 416
Target Start/End: Complemental strand, 1633747 - 1633691
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| | || ||||| ||||||||||||| |
|
|
| T |
1633747 |
cctgtttggataaacagcttatttgcagcttatagcagaagtgcttatcatgataag |
1633691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 362 - 414
Target Start/End: Original strand, 38010283 - 38010335
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgata |
414 |
Q |
| |
|
||||| |||||||||||||| ||||||||| | |||||||| ||||||||||| |
|
|
| T |
38010283 |
tgtttagataaacaacttatttgcagcttatatcacaagtgcttatcatgata |
38010335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 361 - 416
Target Start/End: Original strand, 36534668 - 36534723
Alignment:
| Q |
361 |
ctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
||||||||||||||||||||| | ||| ||| |||| ||||| ||||||||||||| |
|
|
| T |
36534668 |
ctgtttggataaacaacttattttcagtttataacataagtgcttatcatgataag |
36534723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 427
Target Start/End: Original strand, 41407170 - 41407237
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||| | |||||| | |||||||||||||| |||||||| |
|
|
| T |
41407170 |
cctgtttggataaacagcttgtttgcagcttatagcacaagcgcttatcatgataagcacttatgtat |
41407237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 407
Target Start/End: Complemental strand, 41812275 - 41812228
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattat |
407 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| | ||||||||||||| |
|
|
| T |
41812275 |
cctgtttggataaacaacttatttgcagtttatagcacaagtgattat |
41812228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 418
Target Start/End: Complemental strand, 15757867 - 15757809
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcg |
418 |
Q |
| |
|
|||||||||||||||| ||||| | ||||||| | |||||| | ||||||||||||||| |
|
|
| T |
15757867 |
cctgtttggataaacagcttattttcagcttatagcacaagcgcttatcatgataagcg |
15757809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 362 - 427
Target Start/End: Original strand, 2416194 - 2416259
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||||||||| | ||||||| | ||||||| |||||||| |||| | |||||||| |
|
|
| T |
2416194 |
tgtttggataaacaacttattttcagcttatagcacaagttcttatcatgttaagtgcttatgtat |
2416259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 362 - 415
Target Start/End: Complemental strand, 4075027 - 4074974
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataa |
415 |
Q |
| |
|
||||||||||||||| ||||||| |||||| || ||| ||| |||||||||||| |
|
|
| T |
4075027 |
tgtttggataaacaatttatatgaagcttataagacaggtgtttatcatgataa |
4074974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 359 - 396
Target Start/End: Complemental strand, 7043914 - 7043877
Alignment:
| Q |
359 |
tcctgtttggataaacaacttatatgcagcttacaaca |
396 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
7043914 |
tcctgtttggataaacaacttatttgcagcttataaca |
7043877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 400
Target Start/End: Complemental strand, 26143831 - 26143791
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaag |
400 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
26143831 |
cctgtttggataaacaacttatttgcagtttataacacaag |
26143791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 12)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 362 - 427
Target Start/End: Complemental strand, 50662921 - 50662856
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | |||||| | |||||||||| ||||||||||||| |
|
|
| T |
50662921 |
tgtttggataaacaacttatttgcagcttatatcacaagagcttatcatgatgagcgtttatgtat |
50662856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 362 - 427
Target Start/End: Complemental strand, 50681288 - 50681223
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||||||||| | |||||| | |||||| |||||||||||||||||||||||| |
|
|
| T |
50681288 |
tgtttggataaacaacttatttatagcttatagcacaagaacttatcatgataagcgtttatgtat |
50681223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 360 - 416
Target Start/End: Original strand, 44797761 - 44797817
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| | |||||| |||||||||| |||| |
|
|
| T |
44797761 |
cctgtttggataaacaacttatttgcaacttatagcacaagcgattatcatggtaag |
44797817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 364 - 427
Target Start/End: Original strand, 3155486 - 3155549
Alignment:
| Q |
364 |
tttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||||||| ||||||||| | ||||| | |||||||||||||| | ||||||| |
|
|
| T |
3155486 |
tttggataaacaacttatctgcagcttatagtacaagcgcttatcatgataagcatgtatgtat |
3155549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 361 - 418
Target Start/End: Complemental strand, 27083 - 27026
Alignment:
| Q |
361 |
ctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcg |
418 |
Q |
| |
|
||||||||||||||| ||| | ||||||||| | |||||| | ||||||||||||||| |
|
|
| T |
27083 |
ctgtttggataaacatcttgtttgcagcttatagcacaagcgcttatcatgataagcg |
27026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 362 - 427
Target Start/End: Original strand, 11389407 - 11389472
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| | || |||| ||||||||||||| | |||||||| |
|
|
| T |
11389407 |
tgtttggataaacaacttatttgcagtttatatcatgagtgcttatcatgataagtgcttatgtat |
11389472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 421
Target Start/End: Complemental strand, 437430 - 437370
Alignment:
| Q |
361 |
ctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgttt |
421 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| || ||||| ||||||||||||| |||| |
|
|
| T |
437430 |
ctgtttggataaacgacttatttgcagcttataatacaagcttttatcatgataagtgttt |
437370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 364 - 427
Target Start/End: Original strand, 679136 - 679200
Alignment:
| Q |
364 |
tttggataaacaactt-atatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||||| || || |||||| |||||| ||| |||| |||||||||| |||||||| |
|
|
| T |
679136 |
tttggataaacaacttaatttgtagcttataacacatgtgcttataatgataagcgcttatgtat |
679200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 362 - 417
Target Start/End: Original strand, 2987069 - 2987125
Alignment:
| Q |
362 |
tgtttggataaacaactta-tatgcagcttacaacacaagtgattatcatgataagc |
417 |
Q |
| |
|
||||||||||||||| ||| | ||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
2987069 |
tgtttggataaacaagttaatttgcagcttataacataagtgtttatcatgataagc |
2987125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 407
Target Start/End: Original strand, 4212810 - 4212858
Alignment:
| Q |
359 |
tcctgtttggataaacaacttatatgcagcttacaacacaagtgattat |
407 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| | |||||| |||||| |
|
|
| T |
4212810 |
tcctgtttggataaacaacttattttcagcttatagcacaagcgattat |
4212858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 359 - 399
Target Start/End: Complemental strand, 34213770 - 34213730
Alignment:
| Q |
359 |
tcctgtttggataaacaacttatatgcagcttacaacacaa |
399 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| ||||||| |
|
|
| T |
34213770 |
tcctgtttggataagcaacttatttgcagcttataacacaa |
34213730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 51629991 - 51630047
Alignment:
| Q |
361 |
ctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagc |
417 |
Q |
| |
|
|||||| |||||||| ||||| || |||||||||||||||| |||| ||||||||| |
|
|
| T |
51629991 |
ctgtttagataaacaccttatttgaggcttacaacacaagtgcttattatgataagc |
51630047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 11)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 360 - 424
Target Start/End: Complemental strand, 3735692 - 3735628
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatg |
424 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| | |||||| ||||||||||||||||| ||||| |
|
|
| T |
3735692 |
cctgtttggataaacaacctatttgcagcttatagcacaagagattatcatgataagcgcttatg |
3735628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 360 - 428
Target Start/End: Complemental strand, 16938068 - 16938000
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtatt |
428 |
Q |
| |
|
|||||||||| ||||||||||| || |||||| |||||||||| |||||||||||||| ||||||||| |
|
|
| T |
16938068 |
cctgtttggacaaacaacttatttgaagcttataacacaagtgtttatcatgataagcacttatgtatt |
16938000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 360 - 416
Target Start/End: Complemental strand, 9202939 - 9202883
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| | |||||||| ||||||||||||| |
|
|
| T |
9202939 |
cctgtttggataaacatcttatttgcagcttatagcacaagtgtttatcatgataag |
9202883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 361 - 410
Target Start/End: Complemental strand, 12433570 - 12433521
Alignment:
| Q |
361 |
ctgtttggataaacaacttatatgcagcttacaacacaagtgattatcat |
410 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| | ||||||| |
|
|
| T |
12433570 |
ctgtttggataaacaacttatttgcagcttataacacaagcgtttatcat |
12433521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 362 - 427
Target Start/End: Original strand, 32372495 - 32372560
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | |||||| |||||||||||||| |||||||| |
|
|
| T |
32372495 |
tgtttggataaacaacttatttgcagcttatagcacaagcacttatcatgataagcccttatgtat |
32372560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 356 - 416
Target Start/End: Complemental strand, 13697964 - 13697904
Alignment:
| Q |
356 |
tattcctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| |||| ||| ||||||||||||| |
|
|
| T |
13697964 |
tattactgtttggataaacaacttatttgcagcttataacataagcatttatcatgataag |
13697904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 414
Target Start/End: Complemental strand, 7706180 - 7706126
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgata |
414 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||| | |||||||| ||||||||||| |
|
|
| T |
7706180 |
cctgtttgtataaacaacttatttgcaggttatagcacaagtgcttatcatgata |
7706126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 365 - 427
Target Start/End: Complemental strand, 19460572 - 19460510
Alignment:
| Q |
365 |
ttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||||||| ||||| ||||||||| | ||||| || |||||||||||||| |||||||| |
|
|
| T |
19460572 |
ttggataaacagcttatttgcagcttatagcacaaatgcttatcatgataagcacttatgtat |
19460510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 373 - 427
Target Start/End: Original strand, 39105356 - 39105410
Alignment:
| Q |
373 |
acaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||||| ||||||||| | || ||||| ||||||||||||||| |||||||| |
|
|
| T |
39105356 |
acaacttatttgcagcttatagcataagtgcttatcatgataagcgcttatgtat |
39105410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 360 - 425
Target Start/End: Complemental strand, 32703639 - 32703574
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgt |
425 |
Q |
| |
|
||||||| || ||||||||||| ||||||||| | |||||| ||||||||||||||| |||||| |
|
|
| T |
32703639 |
cctgtttagaaaaacaacttatttgcagcttatagcacaagcatttatcatgataagcgcttatgt |
32703574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 40426632 - 40426688
Alignment:
| Q |
361 |
ctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagc |
417 |
Q |
| |
|
|||||||||||||||||| || ||||||||| | |||||| |||||||||||||| |
|
|
| T |
40426632 |
ctgtttggataaacaactcatttgcagcttatagcacaagcacttatcatgataagc |
40426688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 360 - 427
Target Start/End: Complemental strand, 23063719 - 23063652
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||||||| | |||||||| |||| |||| | ||||| ||||||||||||||||||||||||||| |
|
|
| T |
23063719 |
cctgtttggattatcaacttatttgcatcttatagcacaaatgattatcatgataagcgtttatgtat |
23063652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 362 - 427
Target Start/End: Original strand, 34430587 - 34430652
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||| |||||||| ||||| ||||||||| | |||||||| ||||||||||| ||| |||||||| |
|
|
| T |
34430587 |
tgtttcgataaacatcttatttgcagcttatagcacaagtgcttatcatgataggcgcttatgtat |
34430652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 360 - 416
Target Start/End: Original strand, 35069431 - 35069487
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| | |||||| | ||||||||||||| |
|
|
| T |
35069431 |
cctgttttgataaacaacttatttgcagcttatagcacaagcgtttatcatgataag |
35069487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 360 - 413
Target Start/End: Original strand, 24626164 - 24626217
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgat |
413 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| | ||||| || |||||||||| |
|
|
| T |
24626164 |
cctgtttggataaacaacttatttacagcttatagcacaaatgcttatcatgat |
24626217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 416
Target Start/End: Original strand, 264250 - 264306
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
||||||||||| |||| || || ||||||||| | |||||||| ||||||||||||| |
|
|
| T |
264250 |
cctgtttggattaacagctaatttgcagcttatagcacaagtgcttatcatgataag |
264306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 13)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 360 - 427
Target Start/End: Complemental strand, 31365473 - 31365406
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||| |||||||||| ||||| ||||||||| | ||||||||||||||||||||||| |||||||| |
|
|
| T |
31365473 |
cctgtgtggataaacagcttatttgcagcttatagcacaagtgattatcatgataagcacttatgtat |
31365406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 361 - 418
Target Start/End: Original strand, 944363 - 944421
Alignment:
| Q |
361 |
ctgtttggataaacaacttatatgcagcttacaacac-aagtgattatcatgataagcg |
418 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
944363 |
ctgtttggataaacaacttatttgcagcttataacactaagtgcttatcatgataagcg |
944421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 364 - 415
Target Start/End: Complemental strand, 34610993 - 34610942
Alignment:
| Q |
364 |
tttggataaacaacttatatgcagcttacaacacaagtgattatcatgataa |
415 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| | |||||||||||| |
|
|
| T |
34610993 |
tttggataaacaacttatctgcagcttataacacaagcgcttatcatgataa |
34610942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 362 - 424
Target Start/End: Complemental strand, 30956825 - 30956763
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatg |
424 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| | |||||| | |||||||||||||| |||||| |
|
|
| T |
30956825 |
tgtttggataaacagcttatttgcagcttatagcacaagggcttatcatgataagcatttatg |
30956763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 362 - 424
Target Start/End: Complemental strand, 30972637 - 30972575
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatg |
424 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| | |||||| | |||||||||||||| |||||| |
|
|
| T |
30972637 |
tgtttggataaacagcttatttgcagcttatagcacaagggcttatcatgataagcatttatg |
30972575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 359 - 413
Target Start/End: Complemental strand, 46886889 - 46886835
Alignment:
| Q |
359 |
tcctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgat |
413 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| | || ||||| |||||||||| |
|
|
| T |
46886889 |
tcctgtttggataaacaacttatttgcagcttatagcataagtgcttatcatgat |
46886835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 363 - 427
Target Start/End: Complemental strand, 1508779 - 1508715
Alignment:
| Q |
363 |
gtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||| ||||| ||||| |||| |||| | |||||||| ||||||||||||||| |||||||| |
|
|
| T |
1508779 |
gtttggaaaaacagcttatttgcaacttatagcacaagtgcttatcatgataagcgcttatgtat |
1508715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 427
Target Start/End: Original strand, 20257429 - 20257496
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||| |||||||| |||||| |||||||| |||||||| |
|
|
| T |
20257429 |
cctgtttggattaacaatttatttgcagcttataacacaagactttatcacgataagcgcttatgtat |
20257496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 362 - 427
Target Start/End: Complemental strand, 402730 - 402665
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||| | ||||||||||| ||||||| | | |||||||| ||||||||||||| | |||||||| |
|
|
| T |
402730 |
tgtttgaacaaacaacttatttgcagctcatagcacaagtgcttatcatgataagggcttatgtat |
402665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 362 - 427
Target Start/End: Complemental strand, 35959655 - 35959590
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| | |||||| ||||||||||||| | |||||||| |
|
|
| T |
35959655 |
tgtttggataaacagcttatttgcagcttatatcacaagctcttatcatgataagagcttatgtat |
35959590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 400
Target Start/End: Complemental strand, 26990681 - 26990641
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaag |
400 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
26990681 |
cctgtttggatcaacaacttatatgcaacttataacacaag |
26990641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 368 - 416
Target Start/End: Original strand, 28240213 - 28240261
Alignment:
| Q |
368 |
gataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||| | ||||||||||||| |
|
|
| T |
28240213 |
gataaacaacttatctgcagcttatagcacaagcgcttatcatgataag |
28240261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 362 - 426
Target Start/End: Complemental strand, 34235265 - 34235201
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgta |
426 |
Q |
| |
|
|||||||||||||||||||| || |||||| | ||| ||| |||||||||||||| ||||||| |
|
|
| T |
34235265 |
tgtttggataaacaacttatttgtagcttatagtacatgtgcttatcatgataagcacttatgta |
34235201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 359 - 417
Target Start/End: Original strand, 34236040 - 34236098
Alignment:
| Q |
359 |
tcctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagc |
417 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||| | |||||||||||||| |
|
|
| T |
34236040 |
tcctgtttggataaacaacttatttgcagcttataacacaaacggttatcatgataagc |
34236098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 362 - 427
Target Start/End: Complemental strand, 14956494 - 14956429
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | ||||| | |||||||||||||| |||||||| |
|
|
| T |
14956494 |
tgtttggataaacaacttatttgcagcttatagcacaatcgcttatcatgataagcacttatgtat |
14956429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 415
Target Start/End: Complemental strand, 29819080 - 29819026
Alignment:
| Q |
361 |
ctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataa |
415 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | || ||| | |||||||||||| |
|
|
| T |
29819080 |
ctgtttggataaacaacttatttgcagcttatagcaaaagggcttatcatgataa |
29819026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 360 - 393
Target Start/End: Original strand, 18133555 - 18133588
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttaca |
393 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
18133555 |
cctgtttggataaacaacttatttgcagcttaca |
18133588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 360 - 417
Target Start/End: Original strand, 40980999 - 40981056
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagc |
417 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| | |||||| | ||||| |||||||| |
|
|
| T |
40980999 |
cctgtttggataaacagcttatttgcagcttatagcacaagcgcttatcttgataagc |
40981056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 13)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 360 - 415
Target Start/End: Complemental strand, 27863898 - 27863843
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataa |
415 |
Q |
| |
|
|||||||||||||||||||||| || |||||| | |||||||| |||||||||||| |
|
|
| T |
27863898 |
cctgtttggataaacaacttatttgtagcttatagcacaagtgcttatcatgataa |
27863843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 362 - 423
Target Start/End: Complemental strand, 18865249 - 18865188
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttat |
423 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | ||||| | ||||||||||||| |||||| |
|
|
| T |
18865249 |
tgtttggataaacaacttatttgcagcttatagcacaaacgcttatcatgataagtgtttat |
18865188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 364 - 425
Target Start/End: Original strand, 28900760 - 28900821
Alignment:
| Q |
364 |
tttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgt |
425 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |||| |||||||||| |||||| |
|
|
| T |
28900760 |
tttggataaacaacttatttgcagcttataacacaagcatttattatgataagcgcttatgt |
28900821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 360 - 416
Target Start/End: Original strand, 46139821 - 46139877
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
46139821 |
cctgtttggttaaacaacttatttgcagcttataacacaagcacttatcatgataag |
46139877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 427
Target Start/End: Complemental strand, 7241522 - 7241455
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||| |||||||||| ||||| || |||||||||| | ||||||||||| |||||||||| |
|
|
| T |
7241522 |
cctgtttggacgaacaacttatttgcaggttttaacacaagtgttcatcatgataagtgtttatgtat |
7241455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 364 - 411
Target Start/End: Complemental strand, 18965905 - 18965858
Alignment:
| Q |
364 |
tttggataaacaacttatatgcagcttacaacacaagtgattatcatg |
411 |
Q |
| |
|
|||||||||||| |||||||| |||||| |||||||||| |||||||| |
|
|
| T |
18965905 |
tttggataaacatcttatatgtagcttataacacaagtgtttatcatg |
18965858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 427
Target Start/End: Original strand, 19131239 - 19131306
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
|||||||||||||||| ||| | || |||||| | |||||| ||||| ||||||||||||||||||| |
|
|
| T |
19131239 |
cctgtttggataaacagcttgtttgaagcttatagcacaagcaattattatgataagcgtttatgtat |
19131306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 427
Target Start/End: Original strand, 33672957 - 33673024
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||||||||||| | |||| ||||||||| | ||||||| |||| |||||||||| |||||||| |
|
|
| T |
33672957 |
cctgtttggataaactatttatttgcagcttatagcacaagtatttattatgataagcgcttatgtat |
33673024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 427
Target Start/End: Complemental strand, 38500119 - 38500052
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||| |||||||| ||||| ||||| ||| | |||||| | ||||||||||||||| |||||||| |
|
|
| T |
38500119 |
cctgtttagataaacagcttatttgcagtttatagcacaagcgcttatcatgataagcgcttatgtat |
38500052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 427
Target Start/End: Complemental strand, 21568828 - 21568762
Alignment:
| Q |
361 |
ctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtat |
427 |
Q |
| |
|
||||||||||||||| ||| | ||||||||| | || ||||| |||||||||||||| |||||||| |
|
|
| T |
21568828 |
ctgtttggataaacagcttgtttgcagcttatagcataagtgcttatcatgataagcacttatgtat |
21568762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 360 - 418
Target Start/End: Original strand, 45263962 - 45264020
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcg |
418 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| ||||||| | ||||||||| ||||| |
|
|
| T |
45263962 |
cctgtttggataaacaacttatttgcggcttatcacacaagcgcttatcatgaaaagcg |
45264020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 362 - 423
Target Start/End: Original strand, 40196248 - 40196309
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttat |
423 |
Q |
| |
|
|||||||||||||||||||| || || ||||| |||| | | ||||||||||||||| |||| |
|
|
| T |
40196248 |
tgtttggataaacaacttatttgtagtttacagcacatgcgcttatcatgataagcgcttat |
40196309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 416
Target Start/End: Original strand, 33128626 - 33128682
Alignment:
| Q |
360 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataag |
416 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
33128626 |
cctgtttggataaacagcttatttgcagcttacagcacaaacacttatcatgataag |
33128682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 362 - 428
Target Start/End: Original strand, 58475 - 58541
Alignment:
| Q |
362 |
tgtttggataaacaacttatatgcagcttacaacacaagtgattatcatgataagcgtttatgtatt |
428 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | |||||||| || |||| |||||| ||||||||| |
|
|
| T |
58475 |
tgtttggataaacaacttatttgcagcttagagcacaagtgcttgtcataataagcacttatgtatt |
58541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University