View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1022_low_5 (Length: 389)
Name: NF1022_low_5
Description: NF1022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1022_low_5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 33 - 389
Target Start/End: Original strand, 6701181 - 6701538
Alignment:
| Q |
33 |
tgcacatacctgttctggccggagaaaaacaacattccccaaaacgatgacgtttccagattcatccaatatctttgcaaactcaacaccttgttcatga |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6701181 |
tgcacatacctgttctggccggagaaaaacaacattccccaaaacgatgacgtttccagattcatccaatatctttgcaaactcaacaccttgttcatga |
6701280 |
T |
|
| Q |
133 |
ttctcacacgattcaacacagatcctcaaaaactcaccgtaactaactgaattctccgaaacctctctcagtttcctcttcaacttctccatttgcgatg |
232 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6701281 |
ttctcacacgattcaacgcagatcctcaaaaactcaccgtaactaactgaattctccgaaacctctctcagtttcctcttcaacttctccatttgcgatg |
6701380 |
T |
|
| Q |
233 |
ctttcagaatcttcctcgcatcctccaccgtgaacttcgccggcgatgttgccttttccggcgccggtgcataattgagatcaaggaaacgatcaccggt |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6701381 |
ctttcagaatcttcctcgcatcctccaccgtgaacttcgccggcgatgttgccttttccggcgccggtgcaaaattgagatcaaggaaacgatcaccggt |
6701480 |
T |
|
| Q |
333 |
gttaatg-ctttgagtttttccctgagtttttccccgacagggagtgagagaaactcc |
389 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6701481 |
gttaatgcctttgagtttttccctgagtttttctccgacagggagtgagagaaactcc |
6701538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University