View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1023-Insertion-17 (Length: 157)
Name: NF1023-Insertion-17
Description: NF1023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1023-Insertion-17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 38052696 - 38052753
Alignment:
| Q |
8 |
gaaagctctagtagtactaaacatgatttgaatcgcttggaaaaatgtggtagcactg |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052696 |
gaaagctctagtagtactaaacatgatttgaatcgcttggaaaaatgtggtagcactg |
38052753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University