View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1023-Insertion-19 (Length: 57)
Name: NF1023-Insertion-19
Description: NF1023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1023-Insertion-19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 39; Significance: 0.00000000000006; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.00000000000006
Query Start/End: Original strand, 7 - 49
Target Start/End: Complemental strand, 20707500 - 20707458
Alignment:
| Q |
7 |
accgtcttggatgtttctctccaccagacaaaggatattcttc |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20707500 |
accgtcttggatgtttctctccaccagacaaaagatattcttc |
20707458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.00000000000006
Query Start/End: Original strand, 7 - 49
Target Start/End: Complemental strand, 20875544 - 20875502
Alignment:
| Q |
7 |
accgtcttggatgtttctctccaccagacaaaggatattcttc |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20875544 |
accgtcttggatgtttctctccaccagacaaaagatattcttc |
20875502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University