View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10230_high_12 (Length: 228)
Name: NF10230_high_12
Description: NF10230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10230_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 213
Target Start/End: Original strand, 4785576 - 4785783
Alignment:
| Q |
13 |
agcacagacctttaatcttcaacatcctcattgtctctgatgacggatccatttaaaccaatttcatcaagtaacattt-------ctaaccatgatgtt |
105 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
4785576 |
agcacagacctttaatctacaacatcctcattgtctctgatgacggatccatttaaaccaatttcatcaagtaacatttctaatttctaaccatgatgct |
4785675 |
T |
 |
| Q |
106 |
tgacaaactgccaaatataatattcggcttcacatgagaacaatgccaccacattttaagttaaaaaggcatggaccttgatggtgtgacataactttgc |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4785676 |
tgacaaactgccaaatttaatattcggcttcacatgagaacaatgccaccacattttaagttaaaaaggcatggaccttgatggtgtgacataactttgc |
4785775 |
T |
 |
| Q |
206 |
tacaaact |
213 |
Q |
| |
|
|||||||| |
|
|
| T |
4785776 |
tacaaact |
4785783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University