View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10230_low_11 (Length: 285)
Name: NF10230_low_11
Description: NF10230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10230_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 11 - 191
Target Start/End: Complemental strand, 8188645 - 8188465
Alignment:
| Q |
11 |
ggagcacagacagaatttggtgctaggccattgacaagtgttatcgacaacttgaaccgtggacttcctcatagtcagattcctttagcatcagaacatg |
110 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
8188645 |
ggagcacagacagaatctggtgctaggccattgacaagtgttatcgacaacttgaaccgtggacttcctcatagtcatattcctttagcattagaacatg |
8188546 |
T |
 |
| Q |
111 |
ttggagctgagaatactttgtaaggtggcggacatcccatggatgaaaaggctttgtcaaggcttcaagcacggatggaaa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8188545 |
ttggagctgagaatactttgtaaggtggcggacatcccatggatgaaaaggctttgtcagggcttcaagcacggatggaaa |
8188465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 20 - 284
Target Start/End: Complemental strand, 42346644 - 42346378
Alignment:
| Q |
20 |
acagaatttggtgctaggccattgacaagtgttatcgacaacttgaaccgtggacttcctcatagtcagattcctttagcatcagaacatgttggagctg |
119 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| ||| ||||| |||| ||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
42346644 |
acagaatctggtactaggccattgacaagtgttaacgataactttaaccatggacttcctcatagtcagattcctcttgcatcagaacatgttggagctg |
42346545 |
T |
 |
| Q |
120 |
agaatactttgtaaggtggcggacatcccatggatgaaaaggctttgtcaaggcttcaagcacggatggaaagactg--aagtggatcccttgaacctct |
217 |
Q |
| |
|
| |||||||| ||||||| | |||||| | |||||||| ||||||||| |||||||||||||||||||| | ||| ||||||||||||||| ||||| |
|
|
| T |
42346544 |
aaaatactttacaaggtggggtacatcctgtagatgaaaaagctttgtcagggcttcaagcacggatggaacggctgaaaagtggatcccttgaccctct |
42346445 |
T |
 |
| Q |
218 |
gtagtgggattaaggtaaagggaaataatgtccttaccttttttagattttgagtacatatttgcca |
284 |
Q |
| |
|
|||| | ||||||||||||||||| |||| ||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
42346444 |
gtagcgtgattaaggtaaagggaattaatttcctttccttccctagattttgagaacatatttgcca |
42346378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University