View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10230_low_20 (Length: 227)
Name: NF10230_low_20
Description: NF10230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10230_low_20 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 4878512 - 4878738
Alignment:
| Q |
1 |
aaagaacaatttgttaatgcaccccaaattattctttgattctttatatattgatgaattaaactggcaccaaatatcttaattttattttttaagaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||||||| |
|
|
| T |
4878512 |
aaagaacaatttgttaatgcaccccaaattattctttgattctttatatattgatgaattaaattgtcaccaaatagcttaattttattttttaagaaaa |
4878611 |
T |
|
| Q |
101 |
atgaagggannnnnnnctctcgtgttgttgatattattcatcacacaactccataacaaggttgctgctgctttggattccaagttgaacaacaacaata |
200 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4878612 |
atgaagggatttttttctctagtgttgttgatattattcatcacacaactccataacaaggttgctgctgctttggattccaagttgaacaacaacaata |
4878711 |
T |
|
| Q |
201 |
ctcaagttcaaagatgcattggctttc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4878712 |
ctcaagttcaaagatgcattggctttc |
4878738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University