View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10230_low_4 (Length: 372)
Name: NF10230_low_4
Description: NF10230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10230_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 93 - 195
Target Start/End: Complemental strand, 53722484 - 53722385
Alignment:
| Q |
93 |
tgaattgaaagttgaaactggtggtgatttttccagcacagtctttaacaaagagggtagctagagagagaagagaatgaagagactgagaagtgaatca |
192 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53722484 |
tgaattgaaagttgaaactgttg---atttttccagcacagtctttaacaaagagggtagctagagagagaagagaatgaagagactgagaagtgaatca |
53722388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 13 - 59
Target Start/End: Complemental strand, 53722616 - 53722570
Alignment:
| Q |
13 |
gagaggaatcggaatatgagtttctcaaaagaagaaaccttcacaaa |
59 |
Q |
| |
|
||||||||||| ||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
53722616 |
gagaggaatcgaaatctgagtttatcaaaagatgaaaccttcacaaa |
53722570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 81; Significance: 5e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 88 - 195
Target Start/End: Complemental strand, 7357584 - 7357476
Alignment:
| Q |
88 |
ggaaatgaattgaaagttgaaactggtggtgatttttccagcacagtctttaacaaagagggtagctagagagagaag-agaatgaagagactgagaagt |
186 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||| || ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7357584 |
ggaaatgaattgaaagttaaaaccggtggtgatttttccaacagagtctttaacaaagaaggtagctagagagagaagaagaatgaagagactgagaagt |
7357485 |
T |
|
| Q |
187 |
gaatcagat |
195 |
Q |
| |
|
||||||||| |
|
|
| T |
7357484 |
gaatcagat |
7357476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 6 - 59
Target Start/End: Complemental strand, 7357737 - 7357684
Alignment:
| Q |
6 |
agaagcagagaggaatcggaatatgagtttctcaaaagaagaaaccttcacaaa |
59 |
Q |
| |
|
||||| |||||| | ||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
7357737 |
agaagaagagagtagtcggaatctgagtttctcaaaagatgaaaccttcacaaa |
7357684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University