View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10230_low_6 (Length: 350)
Name: NF10230_low_6
Description: NF10230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10230_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 15 - 91
Target Start/End: Complemental strand, 9821308 - 9821232
Alignment:
| Q |
15 |
atctagaacccatgaacagaaacgaaaattggggttggcttgagtatttacccaacaaaatctcaacgagcaactct |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9821308 |
atctagaacccatgaacagaaacaaaaattggggttggcttgagtatttacccaacaaaatctcaacgagcaactct |
9821232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 15002247 - 15002323
Alignment:
| Q |
15 |
atctagaacccatgaacagaaacgaaaattggggttggcttgagtatttacccaacaaaatctcaacgagcaactct |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
15002247 |
atctagaacccatgaacagaaacgaaaattgggcttggcttgagcatttacccaacaaaatctcaatgagcaactct |
15002323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University