View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10230_low_8 (Length: 318)

Name: NF10230_low_8
Description: NF10230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10230_low_8
NF10230_low_8
[»] chr4 (1 HSPs)
chr4 (205-318)||(32822442-32822555)


Alignment Details
Target: chr4 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 205 - 318
Target Start/End: Complemental strand, 32822555 - 32822442
Alignment:
205 ttcaagaaccattgaagcttacacacaactgaagggtcggaatttgagactcgatcacggtgttcgacctaacaatttcaacatttaactgattgagata 304  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||    
32822555 ttcaagaaccattgaagcttacacacaagtgaagggtcggaatttgagactcgatcacggtgtccgatctaacaatttcaacatttaactgattgagata 32822456  T
305 gggatgtgctcttt 318  Q
    ||||||||||||||    
32822455 gggatgtgctcttt 32822442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University