View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10230_low_8 (Length: 318)
Name: NF10230_low_8
Description: NF10230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10230_low_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 205 - 318
Target Start/End: Complemental strand, 32822555 - 32822442
Alignment:
| Q |
205 |
ttcaagaaccattgaagcttacacacaactgaagggtcggaatttgagactcgatcacggtgttcgacctaacaatttcaacatttaactgattgagata |
304 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32822555 |
ttcaagaaccattgaagcttacacacaagtgaagggtcggaatttgagactcgatcacggtgtccgatctaacaatttcaacatttaactgattgagata |
32822456 |
T |
 |
| Q |
305 |
gggatgtgctcttt |
318 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32822455 |
gggatgtgctcttt |
32822442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University