View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10231_low_9 (Length: 210)

Name: NF10231_low_9
Description: NF10231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10231_low_9
NF10231_low_9
[»] chr2 (1 HSPs)
chr2 (14-192)||(26414259-26414437)


Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 26414437 - 26414259
Alignment:
14 cataggatagactccaacaaataggcgtgaattgtgcgggcgagtgtgtttattgtacagaaaattattggcatgtctaaannnnnnncattgctccctc 113  Q
    ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||    
26414437 cataggatagactccaacaaataagcgtaaattgtgcgggcgagtgtgtttattgtacagaaaattattggcatgtctaaatttttttcattgctccctc 26414338  T
114 ccatgtgaatacatgcaatgaagtttttactggttagtaagaatagtaagtcacaatactaaacacatggggatcaggt 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26414337 ccatgtgaatacatgcaatgaagtttttactggttagtaagaatagtaagtcacaatactaaacacatggggatcaggt 26414259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University