View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10231_low_9 (Length: 210)
Name: NF10231_low_9
Description: NF10231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10231_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 26414437 - 26414259
Alignment:
| Q |
14 |
cataggatagactccaacaaataggcgtgaattgtgcgggcgagtgtgtttattgtacagaaaattattggcatgtctaaannnnnnncattgctccctc |
113 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26414437 |
cataggatagactccaacaaataagcgtaaattgtgcgggcgagtgtgtttattgtacagaaaattattggcatgtctaaatttttttcattgctccctc |
26414338 |
T |
 |
| Q |
114 |
ccatgtgaatacatgcaatgaagtttttactggttagtaagaatagtaagtcacaatactaaacacatggggatcaggt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26414337 |
ccatgtgaatacatgcaatgaagtttttactggttagtaagaatagtaagtcacaatactaaacacatggggatcaggt |
26414259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University