View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_high_22 (Length: 363)
Name: NF10233A_high_22
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 19 - 350
Target Start/End: Complemental strand, 2096588 - 2096258
Alignment:
| Q |
19 |
acatcaatcacactttaacttacagtttcaaaccaagagagtgtcactgtgggaaatccccgctgttttgttgcatttttcccgtgcgggagtgacattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2096588 |
acatcaatcacactttaacttacagtttcaaaccaagagagtgtcactgtgggaaatccccgctgttttgttgcatttttctcgtgcgggagtgacattt |
2096489 |
T |
|
| Q |
119 |
gtaggtaatcctttcaagtttaggtgtgaaccattgccttggaatcccatgcatgtcattgatatcatgatagtattggagtaaccaatccttactgcca |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2096488 |
gtaggtaatcctttcaagtttaggggtgaaccattgccttggaatcccatgcatgtcattgatatcatgatagtattggagtaaccaatccttactgcca |
2096389 |
T |
|
| Q |
219 |
tttttgtttccaaaatatcaatgtagtac-ttatatattggttcaacacttatacatatatcccttgatgtctgcatgactgctcaaattaaatattcat |
317 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2096388 |
tttttgtttccaaaatatcaatgtagtactttatatattggttcaacacttatac--atatcccttgatgtctgtatgactgctcaaattaaatattcat |
2096291 |
T |
|
| Q |
318 |
gtatccaggtatataatctccatcgatgtccat |
350 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
2096290 |
gtatccaggtatataatctccatcgatctccat |
2096258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University