View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_high_46 (Length: 251)
Name: NF10233A_high_46
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_high_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 243
Target Start/End: Original strand, 21019451 - 21019677
Alignment:
| Q |
20 |
agtgtaagggttgccctgtactactgata---ggggccttggctgtttgttcttttcgttttcggctccattcttctcttcttgagagttttggatgcat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21019451 |
agtgtaagggttgccctgtactactgatacgtggggccttggctgtttgttcttttcgttttcggctccattcttctcttcttgagagttttggatgcat |
21019550 |
T |
|
| Q |
117 |
taataatatttgctattataaaaaatatatgtttgcagctttcacatcacggtgaataatcttaggagggtcacaactataatgcaagtaagcaatcccc |
216 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21019551 |
taataatatttgctattaaaaaaaaaatatgtttgcagctttcacatcacggtgaataatcttaggagggtcataactataatgcaagtaagcaatcccc |
21019650 |
T |
|
| Q |
217 |
ctggcagatcccagtgcaatattcttc |
243 |
Q |
| |
|
||||||||||||| ||||||||||||| |
|
|
| T |
21019651 |
ctggcagatcccactgcaatattcttc |
21019677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 143 - 239
Target Start/End: Complemental strand, 1435974 - 1435881
Alignment:
| Q |
143 |
atatgtttgcagctttcacatcacggtgaataatcttaggagggtcacaactataatgcaagtaagcaatccccctggcagatcccagtgcaatatt |
239 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1435974 |
atatatttgcagctttcacatcacggtgaataatcttagg---gtcacaactataatgcaagtaagcaatccccctggcagatcccaacgcaatatt |
1435881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 143 - 243
Target Start/End: Complemental strand, 1429364 - 1429267
Alignment:
| Q |
143 |
atatgtttgcagctttcacatcacggtgaataatcttaggagggtcacaactataatgcaagtaagcaatccccctggcagatcccagtgcaatattctt |
242 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||| |||||| || |||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
1429364 |
atatatttgcagctttcacatcacgatgaataatcttagg---gtcacagtgatcatgcaagtaagcaagccctctggcagatcccagtgcaatattctt |
1429268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 143 - 243
Target Start/End: Complemental strand, 1448797 - 1448700
Alignment:
| Q |
143 |
atatgtttgcagctttcacatcacggtgaataatcttaggagggtcacaactataatgcaagtaagcaatccccctggcagatcccagtgcaatattctt |
242 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||| ||||||| || |||||||||||||| ||||||||||| ||| || ||||||||||| |
|
|
| T |
1448797 |
atatatttgcagctttcacatcacgatgaataatcttagg---gtcacaatgatcatgcaagtaagcaagccccctggcagctcctagcgcaatattctt |
1448701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 154 - 243
Target Start/End: Complemental strand, 1441382 - 1441296
Alignment:
| Q |
154 |
gctttcacatcacggtgaataatcttaggagggtcacaactataatgcaagtaagcaatccccctggcagatcccagtgcaatattcttc |
243 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| || |||||||||||||| ||||||||||| |||||| |||||||||||| |
|
|
| T |
1441382 |
gctttcacatcacgatgaataatcttagg---gtcacaatgatcatgcaagtaagcaagccccctggcagctcccagcgcaatattcttc |
1441296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 243
Target Start/End: Complemental strand, 1455542 - 1455456
Alignment:
| Q |
154 |
gctttcacatcacggtgaataatcttaggagggtcacaactataatgcaagtaagcaatccccctggcagatcccagtgcaatattcttc |
243 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||| || |||||||||||| | |||| |||||| |||||| ||||||||||| |
|
|
| T |
1455542 |
gctttcacatcacgatgaataaccttagga---tcacaatgatcatgcaagtaagccagccccttggcagctcccagcccaatattcttc |
1455456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University