View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_107 (Length: 300)
Name: NF10233A_low_107
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_107 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 117 - 293
Target Start/End: Complemental strand, 5989138 - 5988955
Alignment:
| Q |
117 |
gttgctgtgaatagaagnnnnnnngataaaaagtggggtcttgtaggaccacaggaagcttgttttcttggactttcnnnnnnngttggccaattggttt |
216 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||| || |||||||||||||||| |
|
|
| T |
5989138 |
gttgctgtgaatagaagaaaaaaagataaaaagtggggttttgtaggaccacaggaagcttgttttctttgacattttttttttgttggccaattggttt |
5989039 |
T |
|
| Q |
217 |
attctatagtgagggact-------cgggactgaggagtaaatatcttctccatttgtttataataaatgaatcatattattcg |
293 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5989038 |
attctatagtgagggactgaggactcaggactgaggagtaaatatcttctccatttttttataataaatgaatcatattattcg |
5988955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 6 - 83
Target Start/End: Complemental strand, 5989215 - 5989137
Alignment:
| Q |
6 |
actaacaaatcaggaaaaagtcgtaatatttccttttttgaacgttgattgtgaaagc-tttctttctttaatttgagt |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5989215 |
actaacaaatcaggaaaaagtcgtaatatttccttttttgaacgttgattgtgaaagcttttctttctttaatttgagt |
5989137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University