View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_113 (Length: 294)
Name: NF10233A_low_113
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_113 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 288
Target Start/End: Complemental strand, 39920026 - 39919749
Alignment:
| Q |
9 |
gagatgaatgcggaggtttatacagagttttgtgagatttggcatgggcttagtgtgtggtgtgaagtttcaaatctgcggcaactnnnnnnntcgcgtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
39920026 |
gagatgaatgcggaggtttatacagagttttgtgagatttggcatgggcttagtgtgtggtgtgaagtttcaaatccgcggcaactaaaaaaatcgcgtc |
39919927 |
T |
|
| Q |
109 |
gcaatgcactttttggtcatggaacaagaagcagagaatttgcttcactccagacatgcattaactccttcccaccactaaccaaacagacacttaatgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39919926 |
gcaatgcactttttggtcatggaacaagaagcagagaatttgcttcactccagacatgcgttaactccttcccaccactaaccaaacagacacttaatgt |
39919827 |
T |
|
| Q |
209 |
ggccaacttgaggagttttccgaaggtagaacctaactctcaaaatccatcgattattattattcagtttagcgagattt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39919826 |
ggccaacttgaggagttttccgaaggtagaacctaa--ctcaaaatccatcgattattattattaagtttagcgagattt |
39919749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University