View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_129 (Length: 285)
Name: NF10233A_low_129
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_129 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 21 - 255
Target Start/End: Original strand, 40625581 - 40625816
Alignment:
| Q |
21 |
atcacaacatttgatacgttttttcttaacatgatcaccaaacatacnnnnnnn-ctccatctagactatagccaataaacgcacacttctaactcttca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
40625581 |
atcacaacatttgatacgttttttcttaacatgatcaccaaacatacaaaaaaaactccatctagactatagccaataaaggtacacttctaactcttca |
40625680 |
T |
 |
| Q |
120 |
caaaacatgcacttaaatgtaccattggttacctannnnnnnaaatcacgattttaatcttatttatagattcaaaaatatagtgagccagtttgtaaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40625681 |
caaaacatgcacttaaatgtaccattggttacctattttgttaattcacgattttaatcttatttatagattcaaaaatatagtgagccagtttgtaaat |
40625780 |
T |
 |
| Q |
220 |
ttagaaggagacttctaccaccgaatacgagacttg |
255 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
40625781 |
ttagaaggagacttctaccactgaacacgagacttg |
40625816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University