View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_136 (Length: 281)
Name: NF10233A_low_136
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_136 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 89 - 281
Target Start/End: Complemental strand, 22443590 - 22443401
Alignment:
| Q |
89 |
tgtcgaagaatataggacactggcactccctggatatgcgtcccaaaagtacccaaatatattttattttacgaattattattatgataatttgcaagta |
188 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22443590 |
tgtcgaaccatataggacactggcactccctggatatgcgtcccaaaagtacccaaatatattttattttacgaattattattatgataatttgcaagta |
22443491 |
T |
|
| Q |
189 |
cttcccaataacgcacagatacttttctatattgagatacttgtaggatactaacaatgtttttattttaagttcttccgaagacacttttgc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
22443490 |
cttcccaataacgcacagatacttttctatattgagatacttgtaggatactaacaatgttttttttttaag---ttccgaagacacttttgc |
22443401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University