View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_14 (Length: 445)
Name: NF10233A_low_14
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 14 - 293
Target Start/End: Original strand, 34899696 - 34899975
Alignment:
| Q |
14 |
atatgcaaatgttataataagataggcaagagataccaaattatcatattgtcagtgatatcatctgcacaaattcacataaaattttgtagttggaaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899696 |
atatgcaaatgttataataagataggcaagagataccaaattatcatattgtcagtgatatcatctgcacaaattcacataaaattttgtagttggaaga |
34899795 |
T |
 |
| Q |
114 |
tacatacctttcatgtttggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899796 |
tacatacctttcatgtttggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaa |
34899895 |
T |
 |
| Q |
214 |
atagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899896 |
atagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
34899975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University