View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_143 (Length: 278)
Name: NF10233A_low_143
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_143 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 11 - 272
Target Start/End: Complemental strand, 28734900 - 28734639
Alignment:
| Q |
11 |
cagagatatttccaaagcaaacatcaagctttgaccaccttattcaacactgattgctgaggtcaagctcggtcatagcttaattttggtcaatggtgct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28734900 |
cagagatatttccaaagcaaacatcaagctttgaccaccttattcaacactgattgctgaggtcaagctcagtcatagcttaattttggtcaatggtgct |
28734801 |
T |
|
| Q |
111 |
tcagctatgcaggactacaaaatctctcaactgtttcacatccctctcaaatctaaaagggtcagtcccttcactgaaattgcttggaaacctcctagcg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28734800 |
tcagctatgcaggactacaaaatctctcaactgtttcacatccctctcaaatctaaaagggtcagtcccttcactgaaattgcttggaaacctactagcg |
28734701 |
T |
|
| Q |
211 |
gtggaactattaagttcaattgtgatgaatcttctataggggctcacccttgtggggccatt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28734700 |
gtggaactattaagttcaattgtgatgaatcttctataggggctcacccttgtggggccatt |
28734639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 183 - 272
Target Start/End: Complemental strand, 8634570 - 8634481
Alignment:
| Q |
183 |
actgaaattgcttggaaacctcctagcggtggaactattaagttcaattgtgatgaatcttctataggggctcacccttgtggggccatt |
272 |
Q |
| |
|
|||||| || |||||| ||||||| ||||| ||| | |||||||||||||||| ||||||| | ||||| ||||||||||| |||||| |
|
|
| T |
8634570 |
actgaagttacttggattcctcctacaggtggtactgtcaagttcaattgtgatggatcttctgttggggcacacccttgtggtgccatt |
8634481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University