View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_147 (Length: 269)
Name: NF10233A_low_147
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_147 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 28250104 - 28250307
Alignment:
| Q |
17 |
gacatcacgaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250104 |
gacatcacgaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatgg |
28250203 |
T |
|
| Q |
117 |
cgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctctgaagggaagagattgataattaactgtagaaggcttcgttgttttgatct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28250204 |
cgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctccgaagggaagagattgataattaactctagaaggcttcgttgttttgatct |
28250303 |
T |
|
| Q |
217 |
gatg |
220 |
Q |
| |
|
|||| |
|
|
| T |
28250304 |
gatg |
28250307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 65 - 178
Target Start/End: Original strand, 32179733 - 32179846
Alignment:
| Q |
65 |
attcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatggcgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttct |
164 |
Q |
| |
|
||||| |||||||||||| ||||| || | |||||||| |||| ||| || |||||||| || ||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
32179733 |
attcgcttctcgagttcgcgcttgcacgcgcttgaggcgcgtaggtagatagcacaacggagaagacagcagaggaagttgatcggaaaagcagctttct |
32179832 |
T |
|
| Q |
165 |
ctgaagggaagaga |
178 |
Q |
| |
|
| || || |||||| |
|
|
| T |
32179833 |
ccgacggaaagaga |
32179846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University