View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10233A_low_150 (Length: 268)
Name: NF10233A_low_150
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10233A_low_150 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 2 - 259
Target Start/End: Complemental strand, 48780044 - 48779787
Alignment:
| Q |
2 |
caatgcttcttcggatggcagtgaagcctgaagttcacatatttactatagacattatttcagctttagctttgcgttctagtcacagattgcaggtagc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48780044 |
caatgcttcttcggatggcagtgaagcctgaagttcacatatttactatagacattatttcagctttagctttgcgttctagtcacagattgcaagtagc |
48779945 |
T |
|
| Q |
102 |
cgcttggctctatttgtcgatacttttacacaaattatcagattaagaaatacaactgttgacattcgtgaactagaaattagcaaatgtttccctcatc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48779944 |
cgcttggctctatttgtcgatacttttacacaaattatcagattaagaaatacaactgttgacattcgtgaactagaaattagcaaatgtttccctcatc |
48779845 |
T |
|
| Q |
202 |
ctcttaatattctttgcatgaagattctaaattttgttatatatgcttccatattctt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48779844 |
ctcttaatattctttgcatgaagattctaaattttgttatatatgcttccatattctt |
48779787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University